../../tmp/servers/virsirnadb/1813492030
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi2135 | 1 | aatgactccctcaacactggg | 21 | |
| M96362.1 | HPCUNKCDS Hepatitis C virus mRNA, complete cds | 1630 | ..................... | 1650 | 100 |
| U16362.1 | HCU16362 Hepatitis C virus subtype 1b, complete genome | 1630 | ..................... | 1650 | 100 |
| D50485.1 | HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g | 1617 | ..................... | 1637 | 100 |
| D50481.1 | HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g | 1617 | ..................... | 1637 | 100 |
| AJ000009.1 | Hepatitis C virus complete genome sequence | 1612 | ..................... | 1632 | 100 |
| AJ238799.1 | Hepatitis C virus type 1b complete genome, isolate Con1 | 1629 | ..................... | 1649 | 100 |
| AJ238800.1 | Hepatitis C virus type 1b complete genome, isolate NC1 | 1288 | ..................... | 1308 | 100 |
| AF207772.1 | Hepatitis C virus subtype 1b strain MD31, complete genome | 1617 | ..................... | 1637 | 100 |
| AB049093.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT15 | 1598 | ..................... | 1618 | 100 |
| AF356827.1 | Hepatitis C virus subtype 1b isolate HCV-S1, complete genome | 1629 | ..................... | 1649 | 100 |
| AB154179.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154181.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154182.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154186.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154189.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154190.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154192.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154198.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154199.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154201.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| AB154202.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..................... | 1637 | 100 |
| EU234062.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet | 1577 | ..................... | 1597 | 100 |
| EU155223.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet | 1583 | ..................... | 1603 | 100 |
| EU155229.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V159/2004, complet | 1577 | ..................... | 1597 | 100 |
| EU155230.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V160/2002, complet | 1577 | ..................... | 1597 | 100 |
| EU482849.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet | 1577 | ..................... | 1597 | 100 |
| EU482849.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet | 6945 | _.........cgg......__ | 6962 | 71 |
| EU155324.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet | 1577 | ..................... | 1597 | 100 |
| EU155336.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V139/1992, complet | 1577 | ..................... | 1597 | 100 |
| EU155373.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V307/2005, complet | 1577 | ..................... | 1597 | 100 |
| EU660388.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V154/2001, complet | 1578 | ..................... | 1598 | 100 |
| FJ478453.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V2148/1999, comple | 1577 | ..................... | 1597 | 100 |
| FN435993.1 | Hepatitis C virus subtype 1b complete genome, isolate EU1, genomic RN | 1630 | ..................... | 1650 | 100 |
| U01214.1 | HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome | 1630 | ...................._ | 1649 | 95 |
| GU133617.1 | Hepatitis C virus subtype 1b, complete genome | 1629 | ...................._ | 1648 | 95 |
| D13558.1 | HPCJ483 Hepatitis C virus genome, complete sequence | 1629 | ............c........ | 1649 | 95 |
| D10750.1 | HPCJ491 Hepatitis C virus genome, complete sequence | 1629 | ............c........ | 1649 | 95 |
| L02836.1 | HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome | 1618 | ..............t...... | 1638 | 95 |
| D10934.1 | HPCRNA Hepatitis C virus RNA, complete genome sequence | 1629 | .........t........... | 1649 | 95 |
| D63857.1 | HPVHCVN Hepatitis C virus gene for E1 and E2/NS1 envelope glycoprotein | 1536 | ............c........ | 1556 | 95 |
| D89815.1 | Hepatitis C virus genomic RNA, complete sequence | 1629 | ..............a...... | 1649 | 95 |
| AJ132996.1 | Hepatitis C virus, complete genome, isolate HCV-AD78 | 1634 | ........t............ | 1654 | 95 |
| AB016785.1 | Hepatitis C virus genomic RNA, complete sequence | 1633 | ........t............ | 1653 | 95 |
| AF165045.1 | Hepatitis C virus subtype 1b strain MD1-1, complete genome | 1617 | ............c........ | 1637 | 95 |
| AF165053.1 | Hepatitis C virus subtype 1b strain MD5-1, complete genome | 1617 | .............g....... | 1637 | 95 |
| AF165054.1 | Hepatitis C virus subtype 1b strain MD5-2, complete genome | 1617 | .............g....... | 1637 | 95 |
| AF165055.1 | Hepatitis C virus subtype 1b strain MD6-1, complete genome | 1626 | .....t............... | 1646 | 95 |
| AF207753.1 | Hepatitis C virus subtype 1b strain MD12, complete genome | 1617 | .................c... | 1637 | 95 |
| AF207759.1 | Hepatitis C virus subtype 1b strain MD18, complete genome | 1617 | .................c... | 1637 | 95 |
| AF207764.1 | Hepatitis C virus subtype 1b strain MD23, complete genome | 1617 | .................c... | 1637 | 95 |
| AF207768.1 | Hepatitis C virus subtype 1b strain MD27, complete genome | 1617 | .................c... | 1637 | 95 |
| AF207769.1 | Hepatitis C virus subtype 1b strain MD28, complete genome | 1617 | .................g... | 1637 | 95 |
| AB049089.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT10 | 1598 | .................c... | 1618 | 95 |
| AB049091.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 1547 | ............c........ | 1567 | 95 |
| AB049095.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 1598 | .................c... | 1618 | 95 |
| AY045702.1 | Hepatitis C virus isolate HCR6, complete genome | 1631 | .................c... | 1651 | 95 |
| AB154177.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ..............g...... | 1637 | 95 |
| AB154180.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | .................c... | 1637 | 95 |
| AB154185.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ........t............ | 1637 | 95 |
| AB154187.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | .....t............... | 1637 | 95 |
| AB154191.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ........t............ | 1637 | 95 |
| AB154200.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | .................c... | 1637 | 95 |
| AB154203.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | .................c... | 1637 | 95 |
| AB154204.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | .................c... | 1637 | 95 |
| AB249644.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 1629 | ............c........ | 1649 | 95 |
| EF407470.1 | Hepatitis C virus isolate 4064 polyprotein gene, complete cds | 1581 | .................c... | 1601 | 95 |
| EF407471.1 | Hepatitis C virus isolate 5044 polyprotein gene, complete cds | 1574 | .....g............... | 1594 | 95 |
| EF407479.1 | Hepatitis C virus isolate 4036 polyprotein gene, complete cds | 1574 | .................c... | 1594 | 95 |
| EF407487.1 | Hepatitis C virus isolate 6057 polyprotein gene, complete cds | 1576 | ............c........ | 1596 | 95 |
| EF407504.1 | Hepatitis C virus isolate 8069 polyprotein gene, complete cds | 1583 | ............c........ | 1603 | 95 |
| EU239714.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V417/2001, complet | 1578 | .................c... | 1598 | 95 |
| EU155226.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet | 1577 | ............c........ | 1597 | 95 |
| EU482875.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V310/2005, complet | 1577 | ..............g...... | 1597 | 95 |
| EU482879.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V372/2006, complet | 1580 | ..c.................. | 1600 | 95 |
| EU482885.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet | 1580 | .................g... | 1600 | 95 |
| EU155254.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V365/2006, complet | 1578 | ............c........ | 1598 | 95 |
| EU155255.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet | 1577 | ............c........ | 1597 | 95 |
| EU155262.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V381/2001, complet | 1577 | ..c.................. | 1597 | 95 |
| EU155280.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V442/2001, complet | 1577 | ............c........ | 1597 | 95 |
| EU155302.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet | 1577 | ............c........ | 1597 | 95 |
| EU155304.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V347/2003, complet | 1306 | ............c........ | 1326 | 95 |
| EU155317.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet | 1577 | .................c... | 1597 | 95 |
| EU155328.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet | 1577 | ............c........ | 1597 | 95 |
| EU155330.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet | 1599 | ............c........ | 1619 | 95 |
| EU155333.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V133/1989, complet | 1566 | .................c... | 1586 | 95 |
| EU155335.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V136/1992, complet | 1577 | ............c........ | 1597 | 95 |
| EU155361.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V281/2004, complet | 1577 | .....t............... | 1597 | 95 |
| EU155365.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V289/2006, complet | 1577 | .................c... | 1597 | 95 |
| EU155371.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V301/2005, complet | 1577 | .................c... | 1597 | 95 |
| EU155374.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V308/2005, complet | 1599 | ............c........ | 1619 | 95 |
| EU155381.2 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V502/2004, complet | 1577 | .................c... | 1597 | 95 |
| AB426117.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 1629 | ............c........ | 1649 | 95 |
| AB435162.2 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 1629 | ............c........ | 1649 | 95 |
| EU255960.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V312/2006, complet | 1577 | .................c... | 1597 | 95 |
| EU256064.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V376/2006, complet | 1577 | ............c........ | 1597 | 95 |
| EU256066.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V382/2003, complet | 1578 | ............c........ | 1598 | 95 |
| EU256090.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V162/2002, complet | 1577 | .................c... | 1597 | 95 |
| EU256098.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V343/2002, complet | 1577 | ..c.................. | 1597 | 95 |
| EU256103.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V418/2001, complet | 1574 | ..c.................. | 1594 | 95 |
| EU256083.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V299/2005, complet | 1577 | .................c... | 1597 | 95 |
| EU255961.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V137/1991, complet | 1577 | .................c... | 1597 | 95 |
| FJ024086.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1704/2007, comple | 1577 | .................c... | 1597 | 95 |
| FJ390397.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1749/2008, comple | 1577 | ............c........ | 1597 | 95 |
| AB442220.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 1629 | ............c........ | 1649 | 95 |
| D14484.1 | HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome | 1629 | ..c................._ | 1648 | 90 |
| AF054250.1 | Hepatitis C virus subtype 1b strain HC-J4, complete genome | 1619 | ............c.m...... | 1639 | 90 |
| EU482888.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V123/1992, complet | 1580 | ............c......._ | 1599 | 90 |
| EU155326.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet | 1577 | .....g.............._ | 1596 | 90 |
| EU155334.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet | 1577 | ............c......._ | 1596 | 90 |
| EU256061.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V364/2006, complet | 1577 | ............c......._ | 1596 | 90 |
| D90208.1 | HPCJCG Hepatitis C virus ORF gene, complete cds | 1617 | ............c.a...... | 1637 | 90 |
| D11168.1 | HPCJTA Hepatitis C virus (HCV) complete genome | 1629 | .....a...........c... | 1649 | 90 |
| D11355.1 | HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' | 1629 | .....a...........c... | 1649 | 90 |
| S62220.1 | Hepatitis C virus subtype 1b, complete genome | 1628 | ............c.g...... | 1648 | 90 |
| D30613.1 | HPCPP Hepatitis C virus complete genome sequence | 1629 | ...........t.....c... | 1649 | 90 |
| D45172.1 | HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd | 1629 | ...........t.....c... | 1649 | 90 |
| D89872.1 | Hepatitis C virus RNA for polyprotein, complete cds | 1288 | ............c.a...... | 1308 | 90 |
| AF054247.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete | 1629 | ............c.a...... | 1649 | 90 |
| AF054248.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete | 1629 | ............c.a...... | 1649 | 90 |
| AF054249.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete | 1630 | ............c.g...... | 1650 | 90 |
| AF176573.1 | Hepatitis C virus subtype 1b strain 274933RU, complete genome | 1629 | ............c.g...... | 1649 | 90 |
| AF165046.1 | Hepatitis C virus subtype 1b strain MD1-2, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF165049.1 | Hepatitis C virus subtype 1b strain MD3-1, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF165050.1 | Hepatitis C virus subtype 1b strain MD3-2, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF165056.1 | Hepatitis C virus subtype 1b strain MD6-2, complete genome | 1626 | .....t...........c... | 1646 | 90 |
| AF165059.1 | Hepatitis C virus subtype 1b strain MD8-1, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF165060.1 | Hepatitis C virus subtype 1b strain MD8-2, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF165063.1 | Hepatitis C virus subtype 1b strain MD10-1, complete genome | 1617 | ..c..............c... | 1637 | 90 |
| AF165064.1 | Hepatitis C virus subtype 1b strain MD10-2, complete genome | 1617 | ..c..............c... | 1637 | 90 |
| AF207752.1 | Hepatitis C virus subtype 1b strain MD11, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF207755.1 | Hepatitis C virus subtype 1b strain MD14, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF207756.1 | Hepatitis C virus subtype 1b strain MD15, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF207758.1 | Hepatitis C virus subtype 1b strain MD17, complete genome | 1620 | ............c.g...... | 1640 | 90 |
| AF207767.1 | Hepatitis C virus subtype 1b strain MD26, complete genome | 1617 | ............c.g...... | 1637 | 90 |
| AF207770.1 | Hepatitis C virus subtype 1b strain MD29, complete genome | 1617 | ............c.a...... | 1637 | 90 |
| AF207771.1 | Hepatitis C virus subtype 1b strain MD30, complete genome | 1617 | .............g...c... | 1637 | 90 |
| AF207773.1 | Hepatitis C virus subtype 1b strain MD32, complete genome | 1617 | ............c.a...... | 1637 | 90 |
| AB049087.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT05 | 1598 | ............c.g...... | 1618 | 90 |
| AB049088.1 | Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 | 1629 | ............c.g...... | 1649 | 90 |
| AB049090.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 1598 | ..c.........c........ | 1618 | 90 |
| AB049092.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 1598 | .....a...........c... | 1618 | 90 |
| AB049096.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 1598 | ............c.g...... | 1618 | 90 |
| AB049097.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 1598 | ............c.g...... | 1618 | 90 |
| AB049098.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT20 | 1598 | ............c....c... | 1618 | 90 |
| AB049101.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT22 | 1598 | ............c.g...... | 1618 | 90 |
| AF333324.1 | Hepatitis C virus type 1b polyprotein mRNA, complete cds | 1629 | ............c.a...... | 1649 | 90 |
| AF139594.2 | Hepatitis C virus subtype 1b strain HCV-N, complete genome | 1629 | ............c.g...... | 1649 | 90 |
| AB154194.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | .............g...c... | 1637 | 90 |
| AB154205.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ............cg....... | 1637 | 90 |
| AB154206.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 1617 | ............c.a...... | 1637 | 90 |
| EF407461.1 | Hepatitis C virus isolate 5004 polyprotein gene, complete cds | 1609 | ............c.g...... | 1629 | 90 |
| EF407465.1 | Hepatitis C virus isolate 6017 polyprotein gene, complete cds | 1574 | ............c.g...... | 1594 | 90 |
| EF407469.1 | Hepatitis C virus isolate 4014 polyprotein gene, complete cds | 1573 | ............c.g...... | 1593 | 90 |
| EF407480.1 | Hepatitis C virus isolate 3043 polyprotein gene, complete cds | 1576 | ............c.g...... | 1596 | 90 |
| EF407482.1 | Hepatitis C virus isolate 6053 polyprotein gene, complete cds | 1514 | ............c.g...... | 1534 | 90 |
| EF407488.1 | Hepatitis C virus isolate 8016 polyprotein gene, complete cds | 1573 | ............c.g...... | 1593 | 90 |
| EF407497.1 | Hepatitis C virus isolate 5002 polyprotein gene, complete cds | 1573 | ............cg....... | 1593 | 90 |
| EF407502.1 | Hepatitis C virus isolate 2038 polyprotein gene, complete cds | 1658 | ............c.g...... | 1678 | 90 |
| EU234061.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V126/1991, complet | 1577 | ............c....c... | 1597 | 90 |
| EU155217.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet | 1577 | ..c..g............... | 1597 | 90 |
| EU155218.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V145/2005, complet | 1578 | ............c.g...... | 1598 | 90 |
| EU155219.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet | 1577 | .....g...........c... | 1597 | 90 |
| EU155222.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V150/2004, complet | 1577 | ..c...........g...... | 1597 | 90 |
| EU482833.1 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet | 1577 | .....t...a........... | 1597 | 90 |
| EU482839.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V370/2006, complet | 1577 | ..c..............c... | 1597 | 90 |
| EU482859.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V272/2003, complet | 1577 | ............c.a...... | 1597 | 90 |
| EU482860.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V302/2003, complet | 1577 | .....a...........c... | 1597 | 90 |
| EU482881.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V383/2003, complet | 1580 | ............c.g...... | 1600 | 90 |
| EU155256.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V367/2006, complet | 1577 | ............c.g...... | 1597 | 90 |
| EU155257.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V369/2006, complet | 1577 | ............c.g...... | 1597 | 90 |
| EU155261.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V379/2005, complet | 1578 | ...........tc........ | 1598 | 90 |
| EU155263.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V384/2005, complet | 1577 | .....t...........c... | 1597 | 90 |
| EU155301.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V344/2001, complet | 1577 | ............c.a...... | 1597 | 90 |
| EU155306.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet | 1577 | ............c.t...... | 1597 | 90 |
| EU155307.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V353/2002, complet | 1578 | ............c.g...... | 1598 | 90 |
| EU155318.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet | 1577 | ..............a..c... | 1597 | 90 |
| EU155331.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet | 1577 | .....t...........c... | 1597 | 90 |
| EU155359.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V277/2002, complet | 1578 | ..c.........c........ | 1598 | 90 |
| EU155363.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V285/2005, complet | 1577 | ............c....c... | 1597 | 90 |
| EU155368.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V296/2001, complet | 1577 | .....t...........c... | 1597 | 90 |
| EU155369.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V297/2002, complet | 1577 | ............c.g...... | 1597 | 90 |
| EU155370.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V300/2005, complet | 1577 | ..............g..c... | 1597 | 90 |
| EU155382.2 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V504/2003, complet | 1583 | ............cg....... | 1603 | 90 |
| EU529682.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V291/2002, complet | 1295 | ............c.g...... | 1315 | 90 |
| EU660386.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V355/2006, complet | 1577 | ............c.g...... | 1597 | 90 |
| AB429050.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1 | 1629 | ............c.g...... | 1649 | 90 |
| EU256088.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V149/2003, complet | 1577 | ............c.g...... | 1597 | 90 |
| EU256089.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V161/2002, complet | 1577 | ............c.g...... | 1597 | 90 |
| EU256091.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V455/2006, complet | 1295 | ..c...........t...... | 1315 | 90 |
| EU256001.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V144/2002, complet | 1577 | ..............g..c... | 1597 | 90 |
| EU256054.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V443/2001, complet | 1577 | ..c..............c... | 1597 | 90 |
| EU256081.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V293/2002, complet | 1577 | ..c.....t............ | 1597 | 90 |
| EU256082.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V298/2005, complet | 1578 | ............c....c... | 1598 | 90 |
| EU256084.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V303/2003, complet | 1577 | ......a..........c... | 1597 | 90 |
| EU255962.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V140/1991, complet | 1295 | ............c.g...... | 1315 | 90 |
| EU857431.1 | Hepatitis C virus subtype 1b isolate Whu, complete genome | 1629 | ...........t.....c... | 1649 | 90 |
| FJ024277.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1711/2007, comple | 1577 | ............c.a...... | 1597 | 90 |
| FJ024279.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1715/2007, comple | 1577 | ............c.a...... | 1597 | 90 |
| FJ390396.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1748/2007, comple | 1577 | ............c.g...... | 1597 | 90 |
| AB442221.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 1629 | ............c.g...... | 1649 | 90 |
| AF169004.1 | Hepatitis C virus subtype 2a isolate G2aK3, complete genome | 1628 | ...........g.....c.._ | 1647 | 85 |
| AB191333.1 | Hepatitis C virus genomic RNA, complete genome, strain:0 | 1630 | _...........c....c... | 1649 | 85 |
| AJ851228.1 | Hepatitis C virus gene for polyprotein, genomic RNA, isolate Equatori | 1602 | ..c..............c.._ | 1621 | 85 |
| DQ480513.1 | Hepatitis C virus subtype 6a strain 6a35, complete genome | 1583 | .....t...........g.._ | 1602 | 85 |
| EF407485.1 | Hepatitis C virus isolate 7026 polyprotein gene, complete cds | 1584 | ............c.a....._ | 1603 | 85 |
| EU482870.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V75/2004, complete | 1570 | ......ag............_ | 1589 | 85 |
| EU155332.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet | 1577 | ............c.g....._ | 1596 | 85 |
| EU155337.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet | 1577 | ............c.g....._ | 1596 | 85 |
| EU155357.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V275/2003, complet | 1577 | ............c.g....._ | 1596 | 85 |
| EU256065.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V377/2006, complet | 1577 | ............c....c.._ | 1596 | 85 |
| FJ025856.1 | Hepatitis C virus strain P245 polyprotein gene, complete cds | 1478 | ......ag.........y... | 1498 | 85 |
| X61596.1 | Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene | 1612 | ..c..g...a........... | 1632 | 85 |
| M84754.1 | HPCGENANTI Hepatitis C virus subtype 1b strain Taiwan, complete genome | 1629 | ..c.........c.g...... | 1649 | 85 |
| D50483.1 | HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g | 1617 | ............c.a..c... | 1637 | 85 |
| D50480.1 | HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g | 1617 | ............c.a..c... | 1637 | 85 |
| U45476.1 | HCU45476 Hepatitis C virus isolate HD-1, complete genome | 1629 | ............c.g..c... | 1649 | 85 |
| U89019.1 | HCU89019 Hepatitis C virus subtype 1b, complete genome | 1623 | ..c..t...........c... | 1643 | 85 |
| AF165052.1 | Hepatitis C virus subtype 1b strain MD4-2, complete genome | 1617 | ............c.g..c... | 1637 | 85 |
| AF165057.1 | Hepatitis C virus subtype 1b strain MD7-1, complete genome | 1617 | ............c.g..g... | 1637 | 85 |
| AF165058.1 | Hepatitis C virus subtype 1b strain MD7-2, complete genome | 1617 | ............c.g..g... | 1637 | 85 |
| AF207766.1 | Hepatitis C virus subtype 1b strain MD25, complete genome | 1617 | ..c.........c.g...... | 1637 | 85 |
| AF207774.1 | Hepatitis C virus subtype 1b strain MD33, complete genome | 1617 | .........ta.c........ | 1637 | 85 |
| AF483269.1 | Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom | 1594 | ..c..g...........c... | 1614 | 85 |
| DQ071885.1 | Hepatitis C virus subtype 1b polyprotein mRNA, complete cds | 1629 | ..c..t...........c... | 1649 | 85 |
| DQ988073.1 | Hepatitis C virus isolate Eg2 polyprotein gene, partial cds | 1547 | ......ag...a......... | 1567 | 85 |
| DQ988077.1 | Hepatitis C virus isolate Eg9 polyprotein gene, partial cds | 1548 | ......ag...a......... | 1568 | 85 |
| EF407460.1 | Hepatitis C virus isolate 8007 polyprotein gene, complete cds | 1579 | ...........tc.g...... | 1599 | 85 |
| EF407472.1 | Hepatitis C virus isolate 4034 polyprotein gene, complete cds | 1575 | ..c.........c.g...... | 1595 | 85 |
| EF407476.1 | Hepatitis C virus isolate 3012 polyprotein gene, complete cds | 1564 | ...........tc.g...... | 1584 | 85 |
| EF407483.1 | Hepatitis C virus isolate 4043 polyprotein gene, complete cds | 1604 | ..c.........c.g...... | 1624 | 85 |
| EF407492.1 | Hepatitis C virus isolate 7025 polyprotein gene, complete cds | 1569 | ..c.........c.a...... | 1589 | 85 |
| EF407493.1 | Hepatitis C virus isolate 3031 polyprotein gene, complete cds | 1584 | ...........tc.a...... | 1604 | 85 |
| EF407501.1 | Hepatitis C virus isolate 7055 polyprotein gene, complete cds | 1602 | ..c.........c.g...... | 1622 | 85 |
| EU155232.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V164/2002, complet | 1578 | .........a..c.t...... | 1598 | 85 |
| EU155235.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V449/2006, complet | 1577 | ..c.........c.g...... | 1597 | 85 |
| EU482877.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet | 1583 | .....ta..........c... | 1603 | 85 |
| EU482880.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V373/2006, complet | 1580 | ............c.g..c... | 1600 | 85 |
| EU155253.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V363/2006, complet | 1577 | ............c.g..c... | 1597 | 85 |
| EU155300.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V341/2003, complet | 1576 | ............c.g..c... | 1596 | 85 |
| EU155305.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V350/2002, complet | 1577 | ............c.a..c... | 1597 | 85 |
| EU155325.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V122/1991, complet | 1577 | ..c.........c.g...... | 1597 | 85 |
| EU155327.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V125/1992, complet | 1570 | ..c.........c.g...... | 1590 | 85 |
| EU155358.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V276/2004, complet | 1577 | ...........t..g..c... | 1597 | 85 |
| EU155362.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V282/2004, complet | 1577 | ...........tc.a...... | 1597 | 85 |
| EU155372.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V306/2004, complet | 1577 | ..c.........c.g...... | 1597 | 85 |
| EU155377.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V313/2006, complet | 1577 | ...........tc.g...... | 1597 | 85 |
| EU256092.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V463/2006, complet | 1577 | ............c.g..c... | 1597 | 85 |
| EU256099.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V348/2002, complet | 1577 | ............c.g..c... | 1597 | 85 |
| EU256101.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V351/2002, complet | 1577 | ...........tc.a...... | 1597 | 85 |
| EU256075.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V279/2004, complet | 1577 | ............c.g..c... | 1597 | 85 |
| EU256079.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V286/2005, complet | 1578 | ...........tc....c... | 1598 | 85 |
| EU256080.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V292/2002, complet | 1577 | ............c.a..c... | 1597 | 85 |
| EU798760.1 | Hepatitis C virus subtype 6v isolate KMN-02 polyprotein precursor, ge | 1626 | ......ag.........c... | 1646 | 85 |
| FJ390398.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1750/2008, comple | 1577 | ...........tc....c... | 1597 | 85 |
| AB442219.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 1629 | ...........tc.a...... | 1649 | 85 |
| EU862837.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V304/2004, complet | 1584 | ............c.a..c... | 1604 | 85 |
| AF169003.1 | Hepatitis C virus subtype 2a isolate G2aK1, complete genome | 1625 | .........t.g.....c.._ | 1644 | 80 |
| AF169005.1 | Hepatitis C virus subtype 2a isolate NDM59, complete genome | 1628 | .........t.g.....c.._ | 1647 | 80 |
| AF238481.1 | Hepatitis C virus subtype 2a strain MD2a-1, complete genome | 1594 | .........t.g.....c.._ | 1613 | 80 |
| AF238484.1 | Hepatitis C virus subtype 2a strain MD2a-5, complete genome | 1594 | .........t.g.....c.._ | 1613 | 80 |
| AF208024.1 | Hepatitis C virus subtype 1b strain MD34, complete genome | 1611 | ..........a.c.g....._ | 1630 | 80 |
| AB047639.1 | Hepatitis C virus (isolate JFH-1) genomic RNA, complete genome | 1628 | .........t.g.....c.._ | 1647 | 80 |
| AB047644.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-5 | 1628 | ...........gc.a....._ | 1647 | 80 |
| AB047645.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-6 | 1625 | .........t.g.....c.._ | 1644 | 80 |
| AY460204.1 | Hepatitis C virus from Shanghai, complete genome | 1629 | ..c.........c.a....._ | 1648 | 80 |
| EF032886.1 | Hepatitis C virus subtype 1a isolate BR601 polyprotein gene, complete | 1556 | ......ag.........c.._ | 1575 | 80 |
| EF032887.1 | Hepatitis C virus subtype 1a isolate BR554_P1_5.23.03 polyprotein gen | 1563 | ......ag.........c.._ | 1582 | 80 |
| EF032888.1 | Hepatitis C virus subtype 1a isolate BR554_P10_10.21.03 polyprotein g | 1551 | ......ag.........c.._ | 1570 | 80 |
| EF032889.1 | Hepatitis C virus subtype 1a isolate BR554_P16_6.24.04 polyprotein ge | 1535 | ......ag.........c.._ | 1554 | 80 |
| EF032890.1 | Hepatitis C virus subtype 1a isolate BR554_P17_10.21.04 polyprotein g | 1549 | ......ag.........c.._ | 1568 | 80 |
| EF032900.1 | Hepatitis C virus subtype 1a isolate BR111_P5_4.30.03 polyprotein gen | 1549 | ......ag.........c.._ | 1568 | 80 |
| EF621489.1 | Hepatitis C virus subtype 1a strain HC-TN, complete genome | 1629 | ......ag.........c.._ | 1648 | 80 |
| EF638081.1 | Hepatitis C virus subtype 1b from Hubei, complete genome | 1585 | ..c.........c.a....._ | 1604 | 80 |
| EF407475.1 | Hepatitis C virus isolate 3009 polyprotein gene, complete cds | 1561 | ...........tc.a....._ | 1580 | 80 |
| EU246935.1 | Hepatitis C virus strain TH24 polyprotein gene, complete cds | 1567 | ...........t..t..g.._ | 1586 | 80 |
| EU362891.1 | Hepatitis C virus isolate 7003_FU24 polyprotein (pol) gene, partial c | 1551 | ......ag.........c.._ | 1570 | 80 |
| EU155272.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V404/2006, complet | 1525 | ......ag.........c.._ | 1544 | 80 |
| EU155296.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V332/2002, complet | 1545 | ......ag.........c.._ | 1564 | 80 |
| EU529676.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V39/2004, complete | 1561 | ......ag.........c.._ | 1580 | 80 |
| EU255954.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V252/2002, complet | 1554 | .....gag............_ | 1573 | 80 |
| EU256106.1 | Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V32/2004, complete | 1547 | ......ag.........c.._ | 1566 | 80 |
| EU256056.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V7/2003, complete | 1526 | ......ag.........c.._ | 1545 | 80 |
| EU256057.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V702/2006, complet | 1563 | ......ag.........c.._ | 1582 | 80 |
| EU255992.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V213/1992, complet | 1550 | ......ag.........c.._ | 1569 | 80 |
| EU781824.1 | Hepatitis C virus subtype 1a isolate DN14, complete genome | 1536 | .....gag............_ | 1555 | 80 |
| AB442222.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 1632 | ...........tc.g....._ | 1651 | 80 |
| FJ435090.1 | Hepatitis C virus isolate KM181 genotype 6v, complete genome | 1627 | _.....ag.........c... | 1646 | 80 |
| EU862831.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V400/2006, complet | 1547 | ......ag.........c.._ | 1566 | 80 |
| AF207761.1 | Hepatitis C virus subtype 1b strain MD20, complete genome | 1617 | ..c..g..ta........... | 1637 | 80 |
| DQ418785.1 | Hepatitis C virus isolate 02Q polyprotein gene, partial cds | 1550 | ......ag.t.g......... | 1570 | 80 |
| DQ988075.1 | Hepatitis C virus isolate Eg4 polyprotein gene, partial cds | 1547 | ......ag.t.a......... | 1567 | 80 |
| DQ988079.1 | Hepatitis C virus isolate Eg12 polyprotein gene, partial cds | 1547 | ......ag.t.a......... | 1567 | 80 |
| EU155259.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet | 1577 | ..c.........c.a..c... | 1597 | 80 |
| EU155366.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V294/2002, complet | 1577 | ..c.........c.g..c... | 1597 | 80 |
| EU256102.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V415/2001, complet | 1577 | .........t.gc.g...... | 1597 | 80 |
| EU256000.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V143/2003, complet | 1577 | ..c.........c.g..c... | 1597 | 80 |
| Y11604.1 | Hepatitis C virus type 4a RNA for HCV polyprotein | 1567 | ......ag.t.a......... | 1587 | 80 |
| AY232742.1 | Hepatitis C virus clone MD2b7-1 polyprotein mRNA, complete cds | 7063 | __..........g....____ | 7077 | 66 |
| AY232743.1 | Hepatitis C virus clone MD2b7-2 polyprotein mRNA, complete cds | 7063 | __..........g....____ | 7077 | 66 |
| EU862835.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V509/2001, partial | 1577 | ............c..______ | 1591 | 66 |
| M62321.1 | HPCPLYPRE Hepatitis C virus subtype 1a, complete genome | 1629 | .....tag.........c.._ | 1648 | 76 |
| AB047643.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-4 | 1625 | ...........gc.g..c.._ | 1644 | 76 |
| DQ155561.1 | Hepatitis C virus (isolate D54) polyprotein gene, partial cds | 1601 | ...........gc.g..c.._ | 1620 | 76 |
| DQ835770.1 | Hepatitis C virus subtype 6i isolate Th602, complete genome | 1626 | ...........ac.g..g.._ | 1645 | 76 |
| DQ988078.1 | Hepatitis C virus isolate Eg10 polyprotein gene, partial cds | 1543 | .....yag.t.a......... | 1563 | 76 |
| EF032883.1 | Hepatitis C virus subtype 1a isolate 03-32_P1_10.16.03 polyprotein ge | 1551 | .....gag.........c.._ | 1570 | 76 |
| EF032884.1 | Hepatitis C virus subtype 1a isolate 03-32_P2_5.14.04 polyprotein gen | 1530 | .....gag.........c.._ | 1549 | 76 |
| EF032885.1 | Hepatitis C virus subtype 1a isolate 03-32_P4_11.5.05 polyprotein gen | 1550 | .....gag.........c.._ | 1569 | 76 |
| EF424627.1 | Hepatitis C virus subtype 6o isolate QC227, complete genome | 1626 | .....gag.........c.._ | 1645 | 76 |
| EF407432.1 | Hepatitis C virus isolate 1013 polyprotein gene, complete cds | 1590 | ..c...ag.........c.._ | 1609 | 76 |
| EF407437.1 | Hepatitis C virus isolate 1030 polyprotein gene, complete cds | 1589 | ..c...ag.........c.._ | 1608 | 76 |
| EF407449.1 | Hepatitis C virus isolate 2027 polyprotein gene, complete cds | 1589 | .....aag.........c.._ | 1608 | 76 |
| EU362881.1 | Hepatitis C virus isolate 2027_FU24 polyprotein (pol) gene, partial c | 1590 | .....aag.........c.._ | 1609 | 76 |
| EU362899.1 | Hepatitis C virus isolate 1013q polyprotein (pol) gene, partial cds | 1590 | ..c...ag.........c.._ | 1609 | 76 |
| EU362900.1 | Hepatitis C virus isolate 1030q polyprotein (pol) gene, partial cds | 1589 | ..c...ag.........c.._ | 1608 | 76 |
| EU362902.1 | Hepatitis C virus isolate 2027q polyprotein (pol) gene, partial cds | 1589 | .....aag.........c.._ | 1608 | 76 |
| EU155214.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V104/2005, complet | 1555 | ....cgag............_ | 1574 | 76 |
| EU482841.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V387/2004, complet | 1562 | .....tag.........c.._ | 1581 | 76 |
| EU482846.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V439/2000, complet | 1559 | ..c...ag.........c.._ | 1578 | 76 |
| EU482856.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V250/2002, complet | 1547 | .....gag.a.........._ | 1566 | 76 |
| EU482857.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V263/2005, complet | 1546 | ..c...ag.........c.._ | 1565 | 76 |
| EU482882.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V410/2006, complet | 1551 | .....tag.........c.._ | 1570 | 76 |
| EU155271.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V401/2006, complet | 1551 | .....tag.........c.._ | 1570 | 76 |
| EU155309.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V356/2003, complet | 1544 | .....gag.........c.._ | 1563 | 76 |
| EU155343.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V214/1996, complet | 1548 | .....tag.........c.._ | 1567 | 76 |
| EU687193.1 | Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V1562/2005, comple | 1524 | .....tag.........c.._ | 1543 | 76 |
| EU255958.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V265/2005, complet | 1555 | .....gag.........c.._ | 1574 | 76 |
| EU256086.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V110/2003, complet | 1527 | ....cgag............_ | 1546 | 76 |
| EU255993.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V102/2004, complet | 1555 | ..c...ag.........c.._ | 1574 | 76 |
| EU256012.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V511/2006, complet | 1563 | .....gag.........c.._ | 1582 | 76 |
| EU256026.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V82/2002, complete | 1560 | .....tag.........c.._ | 1579 | 76 |
| EU256027.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V83/2003, complete | 1562 | .....tag.........c.._ | 1581 | 76 |
| EU256034.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V95/2006, complete | 1556 | .....gag.a.........._ | 1575 | 76 |
| EU256051.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V4/2005, complete | 1551 | .....tag.........c.._ | 1570 | 76 |
| AF177036.1 | Hepatitis C virus subtype 2a strain HC-J6CH clone pJ6CF, complete gen | 1628 | .........t.gc....c.._ | 1647 | 76 |
| DQ314806.1 | Hepatitis C virus subtype 6g isolate HK6554, complete genome | 7893 | _____..t...........a. | 7878 | 66 |
| EF632069.1 | Hepatitis C virus isolate TV241, complete genome | 4961 | __..c..a..........___ | 4976 | 66 |
| DQ418787.1 | Hepatitis C virus subtype 4a isolate F753 polyprotein gene, complete | 1550 | .....tagt..a......... | 1570 | 76 |
| DQ418789.1 | Hepatitis C virus subtype 4a isolate L835 polyprotein gene, complete | 1549 | .....tagt..a......... | 1569 | 76 |